Detail of EST/Unigene BQ152232 |
Acc. | BQ152232 |
Internal Acc. | NF014D02IR1F1025 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=2e-63; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=7e-59; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=7e-59; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=6e-58; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pyrus pyrifolia E-value=3e-57; |
Length | 827 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | BQ152232 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |