Detail of EST/Unigene BQ152486 |
Acc. | BQ152486 |
Internal Acc. | NF019C03IR1F1020 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 10 kDa polypeptide, chloroplastic OS=Nicotiana tabacum E-value=2e-34; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum lycopersicum E-value=3e-34; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum tuberosum E-value=4e-34; Photosystem II 10 kDa polypeptide, chloroplastic OS=Spinacia oleracea E-value=7e-33; Photosystem II 10 kDa polypeptide, chloroplastic OS=Arabidopsis thaliana E-value=9e-31; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATNACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BQ152486 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42845.1.S1_at
|
Corresponding NCBI Gene | 844245 |
Trichome-related Gene from Literature | N/A |