Detail of EST/Unigene BQ152847 |
Acc. | BQ152847 |
Internal Acc. | NF025G09IR1F1072 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=5e-18; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pyrus pyrifolia E-value=4e-16; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Malus sp. E-value=4e-16; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=4e-16; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=4e-16; |
Length | 667 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ152847 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |