Detail of EST/Unigene BQ154078 |
Acc. | BQ154078 |
Internal Acc. | NF053H06IR1F1059 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=2e-25; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=5e-25; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=5e-25; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=1e-24; |
Length | 624 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ154078 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37311.1.S1_at
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |