| Detail of EST/Unigene BQ154078 |
| Acc. | BQ154078 |
| Internal Acc. | NF053H06IR1F1059 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=2e-25; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=5e-25; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=5e-25; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=1e-24; |
| Length | 624 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (1 ESTs); |
| Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ154078 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.37311.1.S1_at
|
| Corresponding NCBI Gene | 826626 |
| Trichome-related Gene from Literature | N/A |