Detail of EST/Unigene BQ154904 |
Acc. | BQ154904 |
Internal Acc. | NF074B04IR1F1041 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein OSB1, mitochondrial OS=Arabidopsis thaliana E-value=2e-20; Protein OSB3, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=7e-11; Protein OSB2, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Protein OSB4, chloroplastic OS=Arabidopsis thaliana E-value=6e-10; |
Length | 640 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGGAAACAGTGACTTGGGTTATAAGCTCATGGTGAAGGAACTAAATTTTGTTGCTCGAAG |
EST members of Unigene | BQ154904 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34617.1.S1_at
|
Corresponding NCBI Gene | 841183 |
Trichome-related Gene from Literature | N/A |