| Detail of EST/Unigene BQ154904 |
| Acc. | BQ154904 |
| Internal Acc. | NF074B04IR1F1041 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein OSB1, mitochondrial OS=Arabidopsis thaliana E-value=2e-20; Protein OSB3, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=7e-11; Protein OSB2, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Protein OSB4, chloroplastic OS=Arabidopsis thaliana E-value=6e-10; |
| Length | 640 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (1 ESTs); |
| Sequence | TGGAAACAGTGACTTGGGTTATAAGCTCATGGTGAAGGAACTAAATTTTGTTGCTCGAAG |
| EST members of Unigene | BQ154904 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34617.1.S1_at
|
| Corresponding NCBI Gene | 841183 |
| Trichome-related Gene from Literature | N/A |