Detail of EST/Unigene BQ155987 |
Acc. | BQ155987 |
Internal Acc. | NF088A03IR1F1021 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=4e-51; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=9e-48; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=9e-48; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pyrus pyrifolia E-value=2e-46; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Malus sp. E-value=2e-46; |
Length | 600 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | BQ155987 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |