Detail of EST/Unigene BQ156069 |
Acc. | BQ156069 |
Internal Acc. | NF088H05IR1F1048 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=2e-17; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-17; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-17; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-17; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-17; |
Length | 353 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ156069 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37209.1.S1_s_at
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |