Detail of EST/Unigene CA920150 |
Acc. | CA920150 |
Internal Acc. | EST637868 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=9e-25; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=2e-23; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=7e-20; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-19; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=3e-19; |
Length | 642 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); |
Sequence | ACCAATGAATAGTTTTATTTATTAATTAATCATAAAAATAATAAGAATCGTAAATAAACC |
EST members of Unigene | CA920150 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.9686.1.S1_at
|
Corresponding NCBI Gene | 815130 |
Trichome-related Gene from Literature | N/A |