| Detail of EST/Unigene CA920906 |
| Acc. | CA920906 |
| Internal Acc. | EST638624 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=1e-72; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=4e-71; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=6e-65; Cytochrome P450 93A1 OS=Glycine max E-value=1e-43; Cytochrome P450 93A3 OS=Glycine max E-value=2e-42; |
| Length | 792 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); |
| Sequence | CAACTTCTACAACATTATTCATAAGGTTCTTATCAATTTGAATCTTTAGCAAACACACAA |
| EST members of Unigene | CA920906 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.13532.1.S1_at
|
| Corresponding NCBI Gene | 842972 |
| Trichome-related Gene from Literature | N/A |