| Detail of EST/Unigene CA922238 |
| Acc. | CA922238 |
| Internal Acc. | EST639956 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Soyasaponin III rhamnosyltransferase OS=Glycine max E-value=3e-78; Putative UDP-rhamnose:rhamnosyltransferase 1 OS=Fragaria ananassa E-value=4e-56; UDP-glycosyltransferase 91B1 OS=Arabidopsis thaliana E-value=5e-52; UDP-glycosyltransferase 91A1 OS=Arabidopsis thaliana E-value=5e-51; UDP-glycosyltransferase 91C1 OS=Arabidopsis thaliana E-value=9e-45; |
| Length | 822 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); |
| Sequence | TTATGTATATTGAATTTCTAAAGGGCTGATGCTTACAAATTGGTCAAATGTAGAAATTAA |
| EST members of Unigene | CA922238 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
| EC | 2.4.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.11236.1.S1_at
|
| Corresponding NCBI Gene | 836681 |
| Trichome-related Gene from Literature | N/A |