| Detail of EST/Unigene CB065369 |
| Acc. | CB065369 |
| Internal Acc. | EST645050 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protocatechuate 3,4-dioxygenase beta chain OS=Pseudomonas putida E-value=6e-89; Protocatechuate 3,4-dioxygenase beta chain OS=Acinetobacter sp. (strain ADP1) E-value=9e-55; Protocatechuate 3,4-dioxygenase beta chain OS=Burkholderia cepacia E-value=4e-44; Protocatechuate 3,4-dioxygenase alpha chain OS=Acinetobacter sp. (strain ADP1) E-value=3e-12; Catechol 1,2-dioxygenase OS=Acinetobacter sp. (strain ADP1) E-value=4e-08; |
| Length | 526 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | CTCCGAAATACAGCTGGGTGATCAGCTTGGTGGCGATGGCCGGGCCGCTTTTGACACGTG |
| EST members of Unigene | CB065369 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.4119.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |