| Detail of EST/Unigene CB065391 |
| Acc. | CB065391 |
| Internal Acc. | EST645072 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Succinyl-CoA:3-ketoacid coenzyme A transferase subunit B OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=6e-51; Succinyl-CoA:3-ketoacid coenzyme A transferase subunit B OS=Xanthomonas campestris pv. campestris (strain B100) E-value=6e-51; Probable succinyl-CoA:3-ketoacid coenzyme A transferase, mitochondrial OS=Dictyostelium discoideum E-value=1e-49; Succinyl-CoA:3-ketoacid coenzyme A transferase 1, mitochondrial OS=Sus scrofa E-value=2e-48; Succinyl-CoA:3-ketoacid coenzyme A transferase 2, mitochondrial OS=Homo sapiens E-value=7e-48; |
| Length | 572 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | GTTCTCGGCACCGGCCACCAGGTCCATCGCCCCGCCCATGCCCTTGACCAGCTTGCCGGG |
| EST members of Unigene | CB065391 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01028 3-oxoacid CoA-transferase subunit A; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01028 3-oxoacid CoA-transferase subunit A; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01028 3-oxoacid CoA-transferase subunit A; Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01029 3-oxoacid CoA-transferase subunit B; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01029 3-oxoacid CoA-transferase subunit B; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01029 3-oxoacid CoA-transferase subunit B |
| EC | 2.8.3.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.29204.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |