Detail of EST/Unigene CB892762 |
Acc. | CB892762 |
Internal Acc. | EST645554 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 87A1 OS=Arabidopsis thaliana E-value=3e-33; UDP-glycosyltransferase 87A2 OS=Arabidopsis thaliana E-value=1e-30; UDP-glycosyltransferase 75B1 OS=Arabidopsis thaliana E-value=5e-26; UDP-glycosyltransferase 74E2 OS=Arabidopsis thaliana E-value=6e-25; UDP-glycosyltransferase 74E1 OS=Arabidopsis thaliana E-value=2e-24; |
Length | 572 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | TTGTGGTGCTCATCACATGGGATTGATTATGGAATGGTGTGACCAATTGAGAGTTTTGTC |
EST members of Unigene | CB892762 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.3040.1.S1_s_at
|
Corresponding NCBI Gene | 817567 |
Trichome-related Gene from Literature | N/A |