| Detail of EST/Unigene CB893063 |
| Acc. | CB893063 |
| Internal Acc. | EST645855 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Pongo abelii E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Mus musculus E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Homo sapiens E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Bos taurus E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Dictyostelium discoideum E-value=5e-13; |
| Length | 450 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | TGATGGACGAAACATAGTGGGAGTTCTAAAAGGTTTTGACCAGGCAACAAATATAATTCT |
| EST members of Unigene | CB893063 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42298.1.S1_at
|
| Corresponding NCBI Gene | 842881 |
| Trichome-related Gene from Literature | N/A |