Detail of EST/Unigene CB893063 |
Acc. | CB893063 |
Internal Acc. | EST645855 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Pongo abelii E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Mus musculus E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Homo sapiens E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Bos taurus E-value=2e-19; N-alpha-acetyltransferase 38, NatC auxiliary subunit OS=Dictyostelium discoideum E-value=5e-13; |
Length | 450 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | TGATGGACGAAACATAGTGGGAGTTCTAAAAGGTTTTGACCAGGCAACAAATATAATTCT |
EST members of Unigene | CB893063 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42298.1.S1_at
|
Corresponding NCBI Gene | 842881 |
Trichome-related Gene from Literature | N/A |