Detail of EST/Unigene CB893244 |
Acc. | CB893244 |
Internal Acc. | EST646036 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=1e-45; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=1e-42; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=1e-39; Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=2e-39; Ferredoxin-6, chloroplastic OS=Zea mays E-value=2e-38; |
Length | 790 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | CACTTCCTTCTCTCTCAACTGTATGAAAATGTCAGCTGTGAATATGTCCCCTTTGAGACT |
EST members of Unigene | CB893244 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40421.1.S1_at
|
Corresponding NCBI Gene | 817297 |
Trichome-related Gene from Literature | N/A |