| Detail of EST/Unigene CB894623 |
| Acc. | CB894623 |
| Internal Acc. | EST647415 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Small heat shock protein, chloroplastic OS=Pisum sativum E-value=2e-23; Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=7e-10; Small heat shock protein, chloroplastic OS=Solanum lycopersicum E-value=2e-08; Small heat shock protein, chloroplastic OS=Petunia hybrida E-value=4e-08; 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=7e-07; |
| Length | 777 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | ACAACTACTTCACCTATGCTTTCCCCAAAAGCAGGGTACTCGGCAGAAACACGTAACAAG |
| EST members of Unigene | CB894623 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.29347.1.S1_at
|
| Corresponding NCBI Gene | 828881 |
| Trichome-related Gene from Literature | N/A |