Detail of EST/Unigene CB894779 |
Acc. | CB894779 |
Internal Acc. | EST647571 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase HT1 OS=Arabidopsis thaliana E-value=2e-51; Probable serine/threonine-protein kinase DDB_G0267514 OS=Dictyostelium discoideum E-value=7e-49; Probable serine/threonine-protein kinase drkA OS=Dictyostelium discoideum E-value=9e-49; Probable serine/threonine-protein kinase drkB OS=Dictyostelium discoideum E-value=6e-48; Putative serine/threonine-protein kinase/receptor R831 OS=Acanthamoeba polyphaga mimivirus E-value=3e-46; |
Length | 887 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | AGGTTGGACTGAACATCCAAGAGGCACATGCTTTCTCGACAACTGATGGGTTCTCATTAG |
EST members of Unigene | CB894779 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase |
EC | 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
Mtr.16733.1.S1_s_at
|
Corresponding NCBI Gene | 830003 |
Trichome-related Gene from Literature | N/A |