| Detail of EST/Unigene CB894825 |
| Acc. | CB894825 |
| Internal Acc. | EST647617 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Abscisic-aldehyde oxidase OS=Arabidopsis thaliana E-value=6e-68; Indole-3-acetaldehyde oxidase OS=Arabidopsis thaliana E-value=5e-67; Indole-3-acetaldehyde oxidase OS=Zea mays E-value=9e-67; Probable aldehyde oxidase 3 OS=Oryza sativa subsp. japonica E-value=2e-66; Probable aldehyde oxidase 2 OS=Oryza sativa subsp. japonica E-value=1e-65; |
| Length | 624 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | TTTAACAGAATTAGTACTTGGAAAAAAAAGGGAATTTCTCGAATACCAGTTGTTATTCAA |
| EST members of Unigene | CB894825 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00087 xanthine dehydrogenase; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K00106 xanthine oxidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00106 xanthine oxidase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00106 xanthine oxidase |
| EC | 1.17.1.4 1.17.3.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.29357.1.S1_at
|
| Corresponding NCBI Gene | 817257 |
| Trichome-related Gene from Literature | N/A |