Detail of EST/Unigene CB894986 |
Acc. | CB894986 |
Internal Acc. | EST647778 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 1,4-Dihydroxy-2-naphthoyl-CoA synthase, peroxisomal OS=Arabidopsis thaliana E-value=2e-10; 1,4-Dihydroxy-2-naphthoyl-CoA synthase OS=Pasteurella multocida (strain Pm70) E-value=3e-06; |
Length | 123 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (1 ESTs); |
Sequence | ATGAGAAAGCCGAAGGAGAAGGAATTGCCAAGATTAGCATTAATAGGCCGGAGAGGAGGA |
EST members of Unigene | CB894986 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.29363.1.S1_at
|
Corresponding NCBI Gene | 842350 |
Trichome-related Gene from Literature | N/A |