| Detail of EST/Unigene CB894986 |
| Acc. | CB894986 |
| Internal Acc. | EST647778 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1,4-Dihydroxy-2-naphthoyl-CoA synthase, peroxisomal OS=Arabidopsis thaliana E-value=2e-10; 1,4-Dihydroxy-2-naphthoyl-CoA synthase OS=Pasteurella multocida (strain Pm70) E-value=3e-06; |
| Length | 123 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (1 ESTs); |
| Sequence | ATGAGAAAGCCGAAGGAGAAGGAATTGCCAAGATTAGCATTAATAGGCCGGAGAGGAGGA |
| EST members of Unigene | CB894986 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.29363.1.S1_at
|
| Corresponding NCBI Gene | 842350 |
| Trichome-related Gene from Literature | N/A |