Detail of EST/Unigene CN742155 |
Acc. | CN742155 |
Internal Acc. | SAL_US001xg04f1.ab1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-68; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=7e-66; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=6e-64; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-64; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=1e-63; |
Length | 412 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US (1 ESTs); |
Sequence | GCAACCTCTCACTTTCCTCTTGTAAACCATGGCTGCTTCTACAATGGCTCTTTCTTCCCC |
EST members of Unigene | CN742155 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |