| Detail of EST/Unigene CO511838 |
| Acc. | CO511838 |
| Internal Acc. | s13dSG02E1200099_103576 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Peptidyl-prolyl cis-trans isomerase CYP20-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-14; Peptidyl-prolyl cis-trans isomerase TLP20, chloroplastic (Fragments) OS=Spinacia oleracea E-value=4e-10; Peptidyl-prolyl cis-trans isomerase CYP20-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-07; Peptidyl-prolyl cis-trans isomerase, chloroplastic OS=Vicia faba E-value=8e-07; |
| Length | 559 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGGTGATTGCTCTCTAGGTGTTTGTGTTTATGTCTCTATGAAATGGTTTTGTTTTTGTT |
| EST members of Unigene | CO511838 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 5.2.1.8 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.340.1.S1_at
|
| Corresponding NCBI Gene | 831151 |
| Trichome-related Gene from Literature | N/A |