Detail of EST/Unigene CO511838 |
Acc. | CO511838 |
Internal Acc. | s13dSG02E1200099_103576 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Peptidyl-prolyl cis-trans isomerase CYP20-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-14; Peptidyl-prolyl cis-trans isomerase TLP20, chloroplastic (Fragments) OS=Spinacia oleracea E-value=4e-10; Peptidyl-prolyl cis-trans isomerase CYP20-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-07; Peptidyl-prolyl cis-trans isomerase, chloroplastic OS=Vicia faba E-value=8e-07; |
Length | 559 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGGTGATTGCTCTCTAGGTGTTTGTGTTTATGTCTCTATGAAATGGTTTTGTTTTTGTT |
EST members of Unigene | CO511838 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.2.1.8 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.340.1.S1_at
|
Corresponding NCBI Gene | 831151 |
Trichome-related Gene from Literature | N/A |