Detail of EST/Unigene CO511890 |
Acc. | CO511890 |
Internal Acc. | s13dSG05B1000089_103680 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=0; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-96; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-96; RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment) OS=Secale cereale E-value=2e-94; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=3e-94; |
Length | 597 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | TTGAGGATAGTGAATTGGCTGATGTGGCAGCAGTTAGTGCAGGGAACAATCATGAGGTAG |
EST members of Unigene | CO511890 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1750.1.S1_at
|
Corresponding NCBI Gene | 841996 |
Trichome-related Gene from Literature | N/A |