Detail of EST/Unigene CO512056 |
Acc. | CO512056 |
Internal Acc. | s13dSG18C1200086_108432 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chorismate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-52; Chorismate synthase 1, chloroplastic OS=Solanum lycopersicum E-value=6e-51; Chorismate synthase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-50; Chorismate synthase, chloroplastic OS=Corydalis sempervirens E-value=6e-48; Chorismate synthase OS=Cyanothece sp. (strain ATCC 51142) E-value=3e-38; |
Length | 575 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | AAGAGTATTTCATTTCATTGTTAAATCATCATTCTCTATTTCCCAATAGCAATAGCAATA |
EST members of Unigene | CO512056 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1050.1.S1_at
|
Corresponding NCBI Gene | 841307 |
Trichome-related Gene from Literature | N/A |