| Detail of EST/Unigene CO512056 |
| Acc. | CO512056 |
| Internal Acc. | s13dSG18C1200086_108432 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chorismate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-52; Chorismate synthase 1, chloroplastic OS=Solanum lycopersicum E-value=6e-51; Chorismate synthase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-50; Chorismate synthase, chloroplastic OS=Corydalis sempervirens E-value=6e-48; Chorismate synthase OS=Cyanothece sp. (strain ATCC 51142) E-value=3e-38; |
| Length | 575 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | AAGAGTATTTCATTTCATTGTTAAATCATCATTCTCTATTTCCCAATAGCAATAGCAATA |
| EST members of Unigene | CO512056 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1050.1.S1_at
|
| Corresponding NCBI Gene | 841307 |
| Trichome-related Gene from Literature | N/A |