| Detail of EST/Unigene CO512083 |
| Acc. | CO512083 |
| Internal Acc. | s13dSG18F0700059_108486 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S4, chloroplastic OS=Lotus japonicus E-value=4e-42; 30S ribosomal protein S4, chloroplastic OS=Glycine max E-value=3e-41; 30S ribosomal protein S4, chloroplastic OS=Phaseolus vulgaris E-value=4e-41; 30S ribosomal protein S4, chloroplastic OS=Coffea arabica E-value=7e-41; 30S ribosomal protein S4, chloroplastic OS=Nicotiana tabacum E-value=1e-40; |
| Length | 578 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGGTTAACCACAGACATGTTTTAGTTAATGGTCGTATAGTAGATATACCAAGTTATCGT |
| EST members of Unigene | CO512083 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2604.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |