| Detail of EST/Unigene CO512200 |
| Acc. | CO512200 |
| Internal Acc. | s13dSG03B1100089_113914 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=2e-34; 30S ribosomal protein S2, chloroplastic OS=Aethionema cordifolium E-value=9e-33; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=6e-32; 30S ribosomal protein S2, chloroplastic OS=Morus indica E-value=6e-32; 30S ribosomal protein S2, chloroplastic OS=Olimarabidopsis pumila E-value=8e-32; |
| Length | 282 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGAATCTTACTCGAACTGCTCGTTTTTTATCAGAAGCTTGTGATTTGGTTTTTGATGCA |
| EST members of Unigene | CO512200 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1066.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |