Detail of EST/Unigene CO512200 |
Acc. | CO512200 |
Internal Acc. | s13dSG03B1100089_113914 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S2, chloroplastic OS=Lotus japonicus E-value=2e-34; 30S ribosomal protein S2, chloroplastic OS=Aethionema cordifolium E-value=9e-33; 30S ribosomal protein S2, chloroplastic OS=Pisum sativum E-value=6e-32; 30S ribosomal protein S2, chloroplastic OS=Morus indica E-value=6e-32; 30S ribosomal protein S2, chloroplastic OS=Olimarabidopsis pumila E-value=8e-32; |
Length | 282 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGAATCTTACTCGAACTGCTCGTTTTTTATCAGAAGCTTGTGATTTGGTTTTTGATGCA |
EST members of Unigene | CO512200 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1066.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |