| Detail of EST/Unigene CO512289 |
| Acc. | CO512289 |
| Internal Acc. | s13dSG68C0200006_114092 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=2e-58; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=3e-57; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=4e-56; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=2e-55; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=2e-54; |
| Length | 334 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | TTCTTCATCCAAACCAACTCCACTTCTCAAAGATGAACTCGACATCGTTATCCCAACCAT |
| EST members of Unigene | CO512289 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2620.1.S1_at
|
| Corresponding NCBI Gene | 820039 |
| Trichome-related Gene from Literature | 820039 |