| Detail of EST/Unigene CO512315 |
| Acc. | CO512315 |
| Internal Acc. | s13dSG68E0700051_114144 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=1e-27; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=7e-27; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=8e-26; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=4e-25; Putative gamma-glutamyltranspeptidase 3 OS=Homo sapiens E-value=1e-24; |
| Length | 492 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | CTTCAAGTGGAACACTCGCTCTTTCTCTGGTCCTAAACATCTTGGACAGTTATGGACGTC |
| EST members of Unigene | CO512315 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
| EC | 2.3.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1079.1.S1_at
|
| Corresponding NCBI Gene | 829042 |
| Trichome-related Gene from Literature | 829042 |