| Detail of EST/Unigene CO512343 |
| Acc. | CO512343 |
| Internal Acc. | s13dSG68H0100012_114200 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=5e-37; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=1e-31; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=1e-31; Oxygen-evolving enhancer protein 2-3, chloroplastic OS=Nicotiana tabacum E-value=2e-31; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=4e-31; |
| Length | 362 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGGTGGCAAACATCTTAGAGAGTTCAGCACCAGTGATTGGTGGGAAACAGTATTACAAC |
| EST members of Unigene | CO512343 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1083.1.S1_at
|
| Corresponding NCBI Gene | 817630 |
| Trichome-related Gene from Literature | N/A |