Detail of EST/Unigene CO512343 |
Acc. | CO512343 |
Internal Acc. | s13dSG68H0100012_114200 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=5e-37; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=1e-31; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=1e-31; Oxygen-evolving enhancer protein 2-3, chloroplastic OS=Nicotiana tabacum E-value=2e-31; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=4e-31; |
Length | 362 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGGTGGCAAACATCTTAGAGAGTTCAGCACCAGTGATTGGTGGGAAACAGTATTACAAC |
EST members of Unigene | CO512343 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1083.1.S1_at
|
Corresponding NCBI Gene | 817630 |
Trichome-related Gene from Literature | N/A |