| Detail of EST/Unigene CO512369 |
| Acc. | CO512369 |
| Internal Acc. | s13dSG80B0500041_114252 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Spermidine synthase 1 OS=Pisum sativum E-value=5e-83; Spermidine synthase OS=Solanum lycopersicum E-value=3e-74; Spermidine synthase 2 OS=Pisum sativum E-value=3e-74; Spermidine synthase OS=Coffea arabica E-value=8e-73; Spermidine synthase 2 OS=Datura stramonium E-value=8e-73; |
| Length | 534 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGAGGCAAAGAGAAGAAGAAAAAGATGAAGATCAACTACCTCACAATGGTGTCTCTCAA |
| EST members of Unigene | CO512369 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
| EC | 2.5.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1085.1.S1_at
|
| Corresponding NCBI Gene | 838993 |
| Trichome-related Gene from Literature | N/A |