Detail of EST/Unigene CO512369 |
Acc. | CO512369 |
Internal Acc. | s13dSG80B0500041_114252 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Spermidine synthase 1 OS=Pisum sativum E-value=5e-83; Spermidine synthase OS=Solanum lycopersicum E-value=3e-74; Spermidine synthase 2 OS=Pisum sativum E-value=3e-74; Spermidine synthase OS=Coffea arabica E-value=8e-73; Spermidine synthase 2 OS=Datura stramonium E-value=8e-73; |
Length | 534 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGAGGCAAAGAGAAGAAGAAAAAGATGAAGATCAACTACCTCACAATGGTGTCTCTCAA |
EST members of Unigene | CO512369 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1085.1.S1_at
|
Corresponding NCBI Gene | 838993 |
Trichome-related Gene from Literature | N/A |