Detail of EST/Unigene CO512386 |
Acc. | CO512386 |
Internal Acc. | s13dSG80C1000070_114286 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Early light-induced protein, chloroplastic OS=Pisum sativum E-value=3e-40; Desiccation stress protein DSP-22, chloroplastic OS=Craterostigma plantagineum E-value=2e-18; Low molecular mass early light-inducible protein HV60, chloroplastic OS=Hordeum vulgare E-value=1e-14; Low molecular mass early light-inducible protein HV90, chloroplastic OS=Hordeum vulgare E-value=3e-14; High molecular mass early light-inducible protein HV58, chloroplastic OS=Hordeum vulgare E-value=3e-12; |
Length | 507 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | TCCTTAACCATCTAAGGTGCAGTAAAAGAGTTCATTAATATTCACTAAGCTATCCTATCT |
EST members of Unigene | CO512386 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2629.1.S1_at
|
Corresponding NCBI Gene | 821855 |
Trichome-related Gene from Literature | N/A |