| Detail of EST/Unigene CO512490 |
| Acc. | CO512490 |
| Internal Acc. | s13dSG100F070005_114494 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Succinate-semialdehyde dehydrogenase (acetylating) OS=Metallosphaera sedula (strain ATCC 51363 / DSM 5348) E-value=5e-15; Alcohol dehydrogenase OS=Rhizobium meliloti (strain 1021) E-value=3e-11; Alcohol dehydrogenase 2 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=7e-11; Alcohol dehydrogenase 1 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=1e-10; Alcohol dehydrogenase 4, mitochondrial OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=1e-10; |
| Length | 564 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | AATATTATTATGTTCTGAACAAACAAGTATAGATCTCTTGTCTTAATGCCACTTTGTTTT |
| EST members of Unigene | CO512490 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 1.1.1.284 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1100.1.S1_at
|
| Corresponding NCBI Gene | 836482 |
| Trichome-related Gene from Literature | N/A |