| Detail of EST/Unigene CO512537 |
| Acc. | CO512537 |
| Internal Acc. | s13dSG08C0800054_121000 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens E-value=3e-25; Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=3e-25; Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=3e-25; Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=6e-25; Serine hydroxymethyltransferase, mitochondrial OS=Oryctolagus cuniculus E-value=2e-24; |
| Length | 604 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | CGTTGTGTCGTTGTCTACTCTCCGCGCCGCAGCTACTGTTATTTATTTATTCTTCTTCTT |
| EST members of Unigene | CO512537 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1105.1.S1_at
|
| Corresponding NCBI Gene | 829387 |
| Trichome-related Gene from Literature | N/A |