| Detail of EST/Unigene CO512859 |
| Acc. | CO512859 |
| Internal Acc. | s13dSG20E1000071_121644 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase CTR1 OS=Arabidopsis thaliana E-value=3e-27; Putative serine/threonine-protein kinase/receptor R831 OS=Acanthamoeba polyphaga mimivirus E-value=9e-20; Probable serine/threonine-protein kinase DDB_G0267514 OS=Dictyostelium discoideum E-value=3e-19; Probable serine/threonine-protein kinase drkA OS=Dictyostelium discoideum E-value=6e-18; Putative serine/threonine-protein kinase/receptor R818 OS=Acanthamoeba polyphaga mimivirus E-value=8e-18; |
| Length | 457 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GAAAGCAGGGCGCGGTGAAAGTTATCAACCTGTCCAAAATGAAGCTTCAGGATCCTGGTC |
| EST members of Unigene | CO512859 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase |
| EC | 2.7.11.- 2.7.11.1 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
Msa.2657.1.S1_at
|
| Corresponding NCBI Gene | 843117 |
| Trichome-related Gene from Literature | N/A |