Detail of EST/Unigene CO512859 |
Acc. | CO512859 |
Internal Acc. | s13dSG20E1000071_121644 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase CTR1 OS=Arabidopsis thaliana E-value=3e-27; Putative serine/threonine-protein kinase/receptor R831 OS=Acanthamoeba polyphaga mimivirus E-value=9e-20; Probable serine/threonine-protein kinase DDB_G0267514 OS=Dictyostelium discoideum E-value=3e-19; Probable serine/threonine-protein kinase drkA OS=Dictyostelium discoideum E-value=6e-18; Putative serine/threonine-protein kinase/receptor R818 OS=Acanthamoeba polyphaga mimivirus E-value=8e-18; |
Length | 457 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GAAAGCAGGGCGCGGTGAAAGTTATCAACCTGTCCAAAATGAAGCTTCAGGATCCTGGTC |
EST members of Unigene | CO512859 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase |
EC | 2.7.11.- 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
Msa.2657.1.S1_at
|
Corresponding NCBI Gene | 843117 |
Trichome-related Gene from Literature | N/A |