Detail of EST/Unigene CO512871 |
Acc. | CO512871 |
Internal Acc. | s13dSG20G0100004_121668 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 OS=Nicotiana tabacum E-value=4e-59; Probable cytochrome b5 isoform 2 OS=Arabidopsis thaliana E-value=5e-58; Cytochrome b5, seed isoform OS=Nicotiana tabacum E-value=7e-58; Cytochrome b5 OS=Borago officinalis E-value=1e-54; Cytochrome b5 OS=Oryza sativa subsp. japonica E-value=2e-54; |
Length | 436 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | TGAGTACTGATCAATCAACAATGGGTGACGAGCGTAAGGTGTTCACTTTGGCTGATGTCT |
EST members of Unigene | CO512871 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- 1.6.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2661.1.S1_at, Mtr.41232.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |