| Detail of EST/Unigene CO512953 |
| Acc. | CO512953 |
| Internal Acc. | s13dSG86G0800056_121832 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=8e-22; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=2e-21; Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=3e-21; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-15; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-13; |
| Length | 580 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | CGAGAGAGAAGAACGTCAAAAGCCATAAGCGAGTTTGGGAAGGAAAAAAAAACGCTTGTT |
| EST members of Unigene | CO512953 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2670.1.S1_at
|
| Corresponding NCBI Gene | 838446 |
| Trichome-related Gene from Literature | N/A |