| Detail of EST/Unigene CO512995 |
| Acc. | CO512995 |
| Internal Acc. | s13dSG09D0100010_121916 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphatase IMPL1, chloroplastic OS=Arabidopsis thaliana E-value=8e-36; Inositol-1-monophosphatase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-11; Inositol-1-monophosphatase OS=Pasteurella multocida (strain Pm70) E-value=3e-10; Inositol monophosphatase 3 OS=Solanum lycopersicum E-value=6e-10; Inositol-1-monophosphatase OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) E-value=8e-10; |
| Length | 539 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | AGTTTCTCAAAACACAATCTCTATTCCTTTTGGTTCCACCCATCCATCTCATAGCTCATT |
| EST members of Unigene | CO512995 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01092 myo-inositol-1(or 4)-monophosphatase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01092 myo-inositol-1(or 4)-monophosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01092 myo-inositol-1(or 4)-monophosphatase |
| EC | 3.1.3.25 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1148.1.S1_at
|
| Corresponding NCBI Gene | 840007 |
| Trichome-related Gene from Literature | N/A |