| Detail of EST/Unigene CO512997 |
| Acc. | CO512997 |
| Internal Acc. | s13dSG09D0300026_121920 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=1e-24; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=5e-24; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-23; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=5e-21; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=5e-13; |
| Length | 586 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | ACACTTGTTCATTCAGTTTCATTTCTACAAAGCTATCCTTATCCACAAACAACGATAGTG |
| EST members of Unigene | CO512997 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.411.1.S1_at
|
| Corresponding NCBI Gene | 835090 |
| Trichome-related Gene from Literature | N/A |