Detail of EST/Unigene CO513138 |
Acc. | CO513138 |
Internal Acc. | s13dSG23C1000070_129440 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S14, chloroplastic OS=Cicer arietinum E-value=1e-34; 30S ribosomal protein S14, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; 30S ribosomal protein S14, chloroplastic OS=Lotus japonicus E-value=2e-33; 30S ribosomal protein S14, chloroplastic OS=Lobularia maritima E-value=1e-32; 30S ribosomal protein S14, chloroplastic OS=Lemna minor E-value=2e-32; |
Length | 251 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGTCATTTGATTCGAAGATCTCTAAAAAAAGAAATAAGAAAAGCTCAGTCCTTAAGTGA |
EST members of Unigene | CO513138 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.45633.1.S1_s_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |