| Detail of EST/Unigene CO513216 |
| Acc. | CO513216 |
| Internal Acc. | s13dSG24C0900066_129596 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=3e-47; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=3e-30; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-29; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=2e-26; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=3e-26; |
| Length | 579 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGACATGGGGTGCATGAAATCAGGCGAAGTTTTCTCCGAACAGAACCATAAATGGTATG |
| EST members of Unigene | CO513216 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.4.1.134 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1162.1.S1_at
|
| Corresponding NCBI Gene | 835415 |
| Trichome-related Gene from Literature | N/A |