Detail of EST/Unigene CO513216 |
Acc. | CO513216 |
Internal Acc. | s13dSG24C0900066_129596 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=3e-47; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=3e-30; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-29; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=2e-26; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=3e-26; |
Length | 579 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGACATGGGGTGCATGAAATCAGGCGAAGTTTTCTCCGAACAGAACCATAAATGGTATG |
EST members of Unigene | CO513216 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.1.134 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1162.1.S1_at
|
Corresponding NCBI Gene | 835415 |
Trichome-related Gene from Literature | N/A |