Detail of EST/Unigene CO513957 |
Acc. | CO513957 |
Internal Acc. | s13dSG71F0300027_156576 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Mus musculus E-value=2e-12; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Homo sapiens E-value=2e-12; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Bos taurus E-value=2e-12; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=9e-12; DNA-directed RNA polymerases I, II, and III subunit rpabc4 OS=Dictyostelium discoideum E-value=6e-09; |
Length | 291 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | AATCGTCTTCGACTCTCATCAATCAATTACCAATTCCTAGTGATGGATCCTCTGCCCGAG |
EST members of Unigene | CO513957 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03009 DNA-directed RNA Polymerase II subunit K |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.85.1.S1_at
|
Corresponding NCBI Gene | 834103 |
Trichome-related Gene from Literature | N/A |