| Detail of EST/Unigene CO513972 |
| Acc. | CO513972 |
| Internal Acc. | s13dSG71G0900068_156606 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Arabidopsis thaliana E-value=2e-39; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-37; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Gallus gallus E-value=7e-31; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Bos taurus E-value=1e-29; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Rattus norvegicus E-value=2e-29; |
| Length | 339 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGTATAGGTCGCGCGCTTTAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTTC |
| EST members of Unigene | CO513972 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Metabolism of Cofactors and Vitamins > ko00130 Ubiquinone biosynthesis > K06127 ubiquinone biosynthesis methyltransferase |
| EC | 2.1.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1243.1.S1_at
|
| Corresponding NCBI Gene | 835835 |
| Trichome-related Gene from Literature | N/A |