Detail of EST/Unigene CO513972 |
Acc. | CO513972 |
Internal Acc. | s13dSG71G0900068_156606 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Arabidopsis thaliana E-value=2e-39; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-37; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Gallus gallus E-value=7e-31; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Bos taurus E-value=1e-29; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Rattus norvegicus E-value=2e-29; |
Length | 339 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGTATAGGTCGCGCGCTTTAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTTC |
EST members of Unigene | CO513972 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Cofactors and Vitamins > ko00130 Ubiquinone biosynthesis > K06127 ubiquinone biosynthesis methyltransferase |
EC | 2.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1243.1.S1_at
|
Corresponding NCBI Gene | 835835 |
Trichome-related Gene from Literature | N/A |