| Detail of EST/Unigene CO514375 |
| Acc. | CO514375 |
| Internal Acc. | s13dSG84G0900068_157412 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Heat shock 22 kDa protein, mitochondrial OS=Pisum sativum E-value=3e-36; 23.6 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=9e-26; 23.5 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=1e-17; Heat shock 22 kDa protein, mitochondrial OS=Glycine max E-value=1e-16; Small heat shock protein, chloroplastic OS=Chenopodium rubrum E-value=4e-16; |
| Length | 478 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | CACATACGAATTTTCATTTCACTATTCATTCAGTTCAGTATCTCTACTCTCAAACAATCG |
| EST members of Unigene | CO514375 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.509.1.S1_at
|
| Corresponding NCBI Gene | 828623 |
| Trichome-related Gene from Literature | N/A |