Detail of EST/Unigene CO514375 |
Acc. | CO514375 |
Internal Acc. | s13dSG84G0900068_157412 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Heat shock 22 kDa protein, mitochondrial OS=Pisum sativum E-value=3e-36; 23.6 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=9e-26; 23.5 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=1e-17; Heat shock 22 kDa protein, mitochondrial OS=Glycine max E-value=1e-16; Small heat shock protein, chloroplastic OS=Chenopodium rubrum E-value=4e-16; |
Length | 478 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | CACATACGAATTTTCATTTCACTATTCATTCAGTTCAGTATCTCTACTCTCAAACAATCG |
EST members of Unigene | CO514375 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.509.1.S1_at
|
Corresponding NCBI Gene | 828623 |
Trichome-related Gene from Literature | N/A |