Detail of EST/Unigene CO514588 |
Acc. | CO514588 |
Internal Acc. | s13dSG42E0800067_327836 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=2e-55; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=2e-55; 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=4e-54; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Triticum aestivum E-value=3e-53; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=3e-53; |
Length | 543 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | ATGCTCAGCTACTACTACCTCTGCTTCTTCTCTCTTCTCATCTCTAAACCCTAAATCCTC |
EST members of Unigene | CO514588 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1307.1.S1_at
|
Corresponding NCBI Gene | 820335 |
Trichome-related Gene from Literature | N/A |