| Detail of EST/Unigene CO514762 |
| Acc. | CO514762 |
| Internal Acc. | s13dSG55H0600060_328184 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 3, peroxisomal OS=Arabidopsis thaliana E-value=8e-75; Putative acyl-coenzyme A oxidase 3.2, peroxisomal OS=Arabidopsis thaliana E-value=2e-73; Putative acyl-coenzyme A oxidase At3g06690 OS=Arabidopsis thaliana E-value=7e-26; Acyl-coenzyme A oxidase, peroxisomal OS=Cucurbita maxima E-value=9e-16; Acyl-coenzyme A oxidase 2, peroxisomal OS=Arabidopsis thaliana E-value=4e-15; |
| Length | 586 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGGTGAATAGAACGCCTGAGTCAAACAAAGCAATTCATATTGTTTCTAGTGCATACAAG |
| EST members of Unigene | CO514762 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
| EC | 1.3.3.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2776.1.S1_at
|
| Corresponding NCBI Gene | 837140 |
| Trichome-related Gene from Literature | N/A |