| Detail of EST/Unigene CO515254 |
| Acc. | CO515254 |
| Internal Acc. | s13dSG96F0500047_399373 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-80; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-74; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-72; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-66; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-53; |
| Length | 475 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGACACTAAGAGTAGGCAAAATTCAGAAATGGTGGGAAAAGGGTCATCAACCTAACATG |
| EST members of Unigene | CO515254 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.50044.1.S1_at
|
| Corresponding NCBI Gene | 837379 |
| Trichome-related Gene from Literature | N/A |