| Detail of EST/Unigene CO515665 |
| Acc. | CO515665 |
| Internal Acc. | s13dSG60D0200026_419479 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | WEB family protein At5g16730, chloroplastic OS=Arabidopsis thaliana E-value=5e-31; WEB family protein At3g02930, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; WEB family protein At4g27595, chloroplastic OS=Arabidopsis thaliana E-value=2e-24; Putative WEB family protein At1g65010, chloroplastic OS=Arabidopsis thaliana E-value=6e-24; |
| Length | 506 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGAGGATTCAGAACGCCGTCTTCTTATGGCTAAGGAAGAAAATCTTGAAAAGTCAAAGA |
| EST members of Unigene | CO515665 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1408.1.S1_at
|
| Corresponding NCBI Gene | 831536 |
| Trichome-related Gene from Literature | N/A |