Detail of EST/Unigene CO515665 |
Acc. | CO515665 |
Internal Acc. | s13dSG60D0200026_419479 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | WEB family protein At5g16730, chloroplastic OS=Arabidopsis thaliana E-value=5e-31; WEB family protein At3g02930, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; WEB family protein At4g27595, chloroplastic OS=Arabidopsis thaliana E-value=2e-24; Putative WEB family protein At1g65010, chloroplastic OS=Arabidopsis thaliana E-value=6e-24; |
Length | 506 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGAGGATTCAGAACGCCGTCTTCTTATGGCTAAGGAAGAAAATCTTGAAAAGTCAAAGA |
EST members of Unigene | CO515665 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1408.1.S1_at
|
Corresponding NCBI Gene | 831536 |
Trichome-related Gene from Literature | N/A |