Detail of EST/Unigene CO515781 |
Acc. | CO515781 |
Internal Acc. | s13dSG77H0100016_419711 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=7e-61; Hydroxyisourate hydrolase OS=Glycine max E-value=2e-58; Beta-glucosidase 31 OS=Oryza sativa subsp. japonica E-value=2e-55; Beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-54; Beta-glucosidase 4 OS=Arabidopsis thaliana E-value=3e-53; |
Length | 540 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | TACAACAATCTTATCAATGAACTCATTAGAAATGGAATCCAACCACATGTCACACTACAC |
EST members of Unigene | CO515781 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2828.1.S1_at
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |