Detail of EST/Unigene CO515796 |
Acc. | CO515796 |
Internal Acc. | s13dSG54B0400029_421131 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=9e-35; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=9e-35; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=7e-34; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=7e-34; Protochlorophyllide reductase B, chloroplastic OS=Hordeum vulgare E-value=3e-33; |
Length | 439 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGGTCGGAACTCTATTCCCTCCATTCCAGAAGTACATCACCAAAGGCTACGTCTCAGAAG |
EST members of Unigene | CO515796 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1421.1.S1_at
|
Corresponding NCBI Gene | 835507 |
Trichome-related Gene from Literature | N/A |