| Detail of EST/Unigene CO515796 |
| Acc. | CO515796 |
| Internal Acc. | s13dSG54B0400029_421131 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=9e-35; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=9e-35; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=7e-34; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=7e-34; Protochlorophyllide reductase B, chloroplastic OS=Hordeum vulgare E-value=3e-33; |
| Length | 439 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGTCGGAACTCTATTCCCTCCATTCCAGAAGTACATCACCAAAGGCTACGTCTCAGAAG |
| EST members of Unigene | CO515796 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1421.1.S1_at
|
| Corresponding NCBI Gene | 835507 |
| Trichome-related Gene from Literature | N/A |