Detail of EST/Unigene CO516002 |
Acc. | CO516002 |
Internal Acc. | s13dSG61G0700056_445332 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=5e-61; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=3e-40; Glutathione S-transferase U1 OS=Arabidopsis thaliana E-value=4e-39; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=4e-38; Glutathione S-transferase U5 OS=Arabidopsis thaliana E-value=1e-37; |
Length | 421 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | TACAAATCAAGAACATGTGAAACTTTTGGGAGCTACAGGAAGCCCATTTGTTTGCAGGGT |
EST members of Unigene | CO516002 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
EC | 2.5.1.18 5.2.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1436.1.S1_at
|
Corresponding NCBI Gene | 817491 |
Trichome-related Gene from Literature | N/A |