| Detail of EST/Unigene CO516049 |
| Acc. | CO516049 |
| Internal Acc. | s13dSG64D1000090_445426 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative ribonucleoside-diphosphate reductase small chain B OS=Arabidopsis thaliana E-value=7e-29; Ribonucleoside-diphosphate reductase small subunit OS=Dictyostelium discoideum E-value=3e-28; Ribonucleoside-diphosphate reductase small chain A OS=Arabidopsis thaliana E-value=4e-28; Ribonucleoside-diphosphate reductase small chain C OS=Arabidopsis thaliana E-value=6e-28; Ribonucleoside-diphosphate reductase small chain OS=Nicotiana tabacum E-value=2e-27; |
| Length | 224 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | CTATGGATTTCAGATAGCAATCGAGAATATTCATTCTGAGATGTATAGCTTGCTGTTGGA |
| EST members of Unigene | CO516049 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2 |
| EC | 1.17.4.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1441.1.S1_at
|
| Corresponding NCBI Gene | 821937 |
| Trichome-related Gene from Literature | N/A |